DETAILED VIEW
VDRC ID 49247
Library GD Stocks (GD)
Construct ID 17411
CG Number (r6.01) CG2248
FlyBase gene number FBgn0010333
FBgn0014012
FlyBase recombinant construct FBtp0029089
FlyBase Reference Reports FBrf0206747
FBrf0231848
FBrf0226645
FBrf0221420
FBrf0200327
FBrf0241638
FBrf0202579
Synonyms 2248
DmRAC
Dmrac1
Dm Rac1
DmRAC1
dRac
Drac
DRac
D-Rac
dRac1
Drac1
DRac1
D-Rac1
D-Rac 1
Drac1a
DracA
DRacA
GTPase Rac1
P40792
rac
Rac
rac1
Rac1
Rac-1
RAC1
Rac3
RacA
Rac GTPase
Hairpin Length 314
ON Targets 1
OFF Targets 1
s19 0.95
CAN Repeats 2
Viability viable
Inserted Chromosome 1
Left Primer CGCGAATTCTGAATCCGGCATCGTTCGAG
Right Primer GCGTCTAGAGCACTTGCGCTTGGACTTGG
Template cDNA
Sequence TGAATCCGGC ATCGTTCGAG AACGTGCGGG CCAAGTGGTA TCCGGAGGTG CGCCACCACT GCCCCAGCAC GCCCATCATC CTGGTGGGCA CCAAGCTGGA TTTGCGCGAC GACAAGAACA CAATCGAAAA GCTGAGGGAC AAGAAACTGG CGCCCATCAC CTATCCGCAG GGCCTGGCCA TGGCCAAGGA AATCGGAGCG GTCAAGTATC TGGAGTGCTC GGCCCTGACG CAGAAGGGTC TGAAAACCGT TTTCGACGAG GCCATCCGGT CGGTTTTGTG CCCCGTGCTG CAGCCCAAGT CCAAGCGCAA GTGC