DETAILED VIEW
VDRC ID 46745
Library GD Stocks (GD)
Construct ID 9445
CG Number (r6.01) CG40411
FlyBase gene number FBgn0046268
FBgn0010247
FBgn0039975
FBgn0058411
FBgn0039998
Synonyms BEST:LD21673
CG17685
CG17696
CG17718
dmparp
Dm.pARTa
dPARP
D.PARP
LD21673.3prime
parp
Parp
PARP
Parp1
PARP1
PARP-1
poly ADP ribose polymerase
poly-(ADP-ribose) polymerase
poly(ADP-ribose) polymerase
Poly-(ADP-ribose) polymerase
Poly(ADP-ribose) polymerase
Poly(ADP-)Ribose Polymerase
Poly(ADP)-Ribose Polymerase
Poly(ADP ribose) polymerase 1
Poly(ADP-ribose) Polymerase 1
Hairpin Length 302
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCACAAGAAGTTATAAGCGCACAATTAGGAAAA
Right Primer GCGTCTAGAGATCATCATCTGCTAAGCTCTGAAATCC
Template genomic
Sequence ACAAGAAGTT ATAAGCGCAC AATTAGGAAA AAAGCGATCG AAGGCTTTTA ACTTAGCATT AAAAGACTTT GGGATTGAAT ATGCAAAATC TAGTCGATCG ACGTGTCGTG GATGTGAACA AAAAATAAAC AAGGATCTAG TTCGCTTACG TAAAACTGTT TATGATACTG AAGTTGGTAT GAAGTACGGA GGCCAACCTT TGTGGCATCA TTTGGAATGC TTCGCCCAAT TGCGCTCTGA GCTTGGCTGG TTTGCGTCAG GTGAAGATAT GCCAGGATTT CAGAGCTTAG CAGATGATGA TC