DETAILED VIEW
VDRC ID 46200
Library GD Stocks (GD)
Construct ID 12152
CG Number (r6.01) CG7146
FlyBase gene number FBgn0038593
Synonyms Vacuolar protein sorting 39
vps39
Vps39
Hairpin Length 326
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCGATGTCACCGTGCCTACGTCCA
Right Primer GCGTCTAGAGCCTCCTTGTGCTTGCCCTTC
Template genomic
Sequence GATGTCACCG TGCCTACGTC CAGTACTCCG GCGCTTGAGG ATAGCGACCT GGAGAACGCC TACTTGGCAC TGATCGAGTA TCTGGCATGG GCCCGACAGC GGGAGGTGGT CAAGCTGCGC GACACTAAAA GTAGTTCAAA GTCCCTGCTG GAGATCATCG ATACAACGTT GCTGAAGTGT TACCTGCAGA CAAACGACTC TCTGGTGGCA CCACTGCTAC GCCTAAACCA GTGCCACTTA GAGGAGTCGG AAAAGACGTT GAAGAAGCAC AACAAGATCT CTGAACTTAT CATCCTCTAC CAGATGAAGG GCAAGCACAA GGAGGC