DETAILED VIEW
VDRC ID 43848
Library GD Stocks (GD)
Construct ID 3825
CG Number (r6.01) CG13586
FlyBase gene number FBgn0046758
FBgn0035023
Synonyms BcDNA:SD05282
chgh
CHH-like
DrmITP
Drm-ITP
DrmITPL1
DrmITPL2
ion transport peptide
Ion transport peptide
ion transport polypeptide
itp
Itp
ITP
Hairpin Length 353
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 3
Viability lethal
Inserted Chromosome 3
Left Primer CGCGAATTCGCACCACAACCAGCGATAAGCA
Right Primer CGCTCTAGATTTCAGGCATTCGCCAAACCA
Template cDNA
Sequence GCACCACAAC CAGCGATAAG CATCCGAAGA CGAAGATTTG GGTGGCCCAG TCCACAGAAA GCCCCGCACC AACCCCGAAA CAAGCGCCTA AGATGTGTTC CCGCAACATA AAGATCTCGG TGGTGCTGTT TCTTGTCCTG ATACCAATCT TCGCCGCCTT GCCACACAAC CACAATCTGT CGAAGCGCAG CAACTTCTTC GACCTGGAGT GCAAGGGCAT CTTCAACAAG ACCATGTTCT TCCGACTGGA CCGCATCTGC GAGGACTGCT ACCAGTTGTT CCGCGAGACG AGTATACACC GATTATGCAA GAAAGACTGC TTTGATTCAA AATGGTTTGG CGAATGCCTG AAA