DETAILED VIEW
VDRC ID 43123
Library GD Stocks (GD)
Construct ID 4697
CG Number (r6.01) CG12559
FlyBase gene number FBgn0042217
FBgn0039983
FBgn0005693
FBgn0047177
FBgn0003256
Synonyms 12559
BcDNA:RE08694
CG18732
CT34260
CT39192
dERK
DERK
D-ERK
DERK-A
Diphospho-ERK
dm-dpERK
DmErk
DmERKA
DmERK-A
DmMAPK
dpErk
dpERk
dpERK
dp-ERK
DpErk
DpERK
dpERK1
dpMAPK
Drosophila ERK
Dsor2
EK2-1
Enhancer of seven in absentia 7
erk
Erk
ERK
Erk1
ErkA
ERKa
ERKA
ERK-A
Erk/Map kinase
Erk MAP kinase
ERK/rolled
E(sina)7
Extracellular-regulated kinase A
extracellular signal-regulated kinase
extracellular signal-regulated kinase A
Extracellular-signal-related kinase A
EY2-2
GroupII
l(2)41Ac
l(2R)EMS45-39
mapk
Mapk
MapK
MAP-k
MAPK
MAP kinase
MAP-kinase
mitogen activated protein kinase
mitogen-activated protein kinase
pERK
phospho-ERK
pMapK
pMAPK
rl
Rl
RL
rl/ERK
rll
rl/MAPK
roll
rolled
Rolled
sem
Sem
SEM
sevenmaker
Sevenmaker
SR2-1
Su(Raf)2B
Hairpin Length 301
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCGGATCTACGGAAGTTCCTCAATCTAATGCT
Right Primer CGCTCTAGAAAACATCTCTCATTTGGTCTATGCTATCAACTC
Template cDNA
Sequence GGATCTACGG AAGTTCCTCA ATCTAATGCT GAAGTTATAA GGGGACAAAT ATTTGAAGTT GGTCCTAGGT ATATTAAACT CGCCTATATA GGTGAAGGAG CTTATGGCAT GGTTGTGTCT GCGGATGACA CGCTAACAAA CCAAAGAGTT GCAATAAAAA AAATATCGCC CTTTGAACAC CAAACTTATT GTCAAAGGAC TCTCAGAGAA ATAACCATAT TGACCAGATT TAAACATGAA AACATTATTG ATATTCGAGA TATTCTTCGA GTTGATAGCA TAGACCAAAT GAGAGATGTT T