DETAILED VIEW
VDRC ID 43082
Library GD Stocks (GD)
Construct ID 4624
CG Number (r6.01) CG18803
FlyBase gene number FBgn0042202
FBgn0019947
Synonyms CG5868
DmPS
dPresenilin
Dpresenilin
Dps
DPS
dPsn
DPsn
DrosPS
l(3)77CDb
pres
pre-senelin
presenilin
Presenilin
PS
PS1
psn
Psn
PSN
Hairpin Length 324
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 5
Viability lethal
Inserted Chromosome 3
Left Primer CGCGAATTCGATGAGCGTGGTGGTGGTGATG
Right Primer CGCTCTAGACAGGCAGTCCATTCAGGCAGGT
Template cDNA
Sequence GATGAGCGTG GTGGTGGTGA TGACCTTTTT GCTGATTGTT TTGTACAAGA AGCGTTGCTA TCGCATCATT CACGGCTGGC TGATTCTCTC CTCCTTCATG TTGTTGTTCA TTTTTACGTA CTTATATTTG GAAGAGCTTC TTCGCGCCTA TAACATACCG ATGGACTACC CTACTGCACT ACTGATTATG TGGAACTTTG GAGTGGTCGG AATGATGTCC ATCCATTGGC AGGGACCTCT GCGGTTGCAG CAAGGATATC TCATTTTCGT GGCAGCCTTG ATGGCCTTGG TGTTCATTAA ATACCTGCCT GAATGGACTG CCTG