DETAILED VIEW
VDRC ID 43077
Library GD Stocks (GD)
Construct ID 4614
CG Number (r6.01) CG17697
FlyBase gene number FBgn0036418
FBgn0001085
FBgn0036420
Synonyms CG3646
dFz
Dfz
DFz
Dfz1
DFz1
DFZ1
Dm Fz1
frizzled
Frizzled
frizzled 1
frizzled[[1]]
Frizzled1
Frizzled 1
frz
Frz
fz
Fz
FZ
fz1
fz[[1]]
Fz1
Hairpin Length 323
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCTGTCTGGCATTCGCCTGGTTTT
Right Primer CGCTCTAGATTGTCTGTCCTCTTTCCGTCCGTTT
Template cDNA
Sequence TGTCTGGCAT TCGCCTGGTT TTTGGCCGCT GGCCTCAAAT GGGGCCACGA GGCGATTGAG AACAAGTCGC ACTTATTCCA CCTGGTTGCC TGGGCGGTGC CCGCCCTTCA GACCATCTCC GTTCTGGCCC TGGCTAAAGT TGAAGGTGAC ATCCTTTCTG GCGTTTGTTT CGTGGGCCAG CTGGACACGC ACTCCCTGGG CGCGTTCCTG ATCCTTCCAC TCTGCATTTA TCTCTCGATC GGAGCACTAT TCCTGCTGGC CGGATTTATT TCGCTTTTCC GGATCCGGAC AGTTATGAAA ACGGACGGAA AGAGGACAGA CAA