DETAILED VIEW
VDRC ID 4299
Library GD Stocks (GD)
Construct ID 2613
CG Number (r6.01) CG1389
FlyBase gene number FBgn0003733
Synonyms splc
spliced
tor
Tor
TOR
torso
Torso
Hairpin Length 201
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability lethal
Inserted Chromosome 3
Left Primer CGCTCTAGAGCTCCAAAGGATCGGCCAAAA
Right Primer CGCGAATTCCATTCCCACCGCCACCTGTT
Template genomic
Sequence GCTCCAAAGG ATCGGCCAAA ACGGAAGCTG AAGCCGCAGC CCAAGAAAGA CTCGAAGCAG GATTTCAAAT CGGACAACAA GAAGCGAATC TTTGAGAACA AGGAATACTT TGATTGCCTC GACTCATCGG ATACCAAGCC CCGAATACCA CTGAAATATG CAGATTTGCT AGACATCGCC CAACAGGTGG CGGTGGGAAT G