DETAILED VIEW
VDRC ID 41192
Library GD Stocks (GD)
Construct ID 5222
CG Number (r6.01) CG12233
FlyBase gene number FBgn0031024
FBgn0027291
Synonyms l (1) G0156
l(1)G0156
lethal (1) G0156
Lethal(1)G0156
Hairpin Length 363
ON Targets 1
OFF Targets 2
s19 0.99
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCCCGACGGAAAGTTCGGCATC
Right Primer GCGTCTAGACCTTCTTGCGGTTGTTGTTCTTGG
Template genomic
Sequence CCGACGGAAA GTTCGGCATC CCACAGGCCG CCATTGACTC GGTGAACACG AACAAGATCG GCCTGAAGGG TCCTCTGATG ACGCCCGTCG GCAAGGGCCA TCGGTCTCTG AATCTGGCCC TGCGCAAGGA GTTCAATCTG TACGCCAACG TGCGTCCCTG CCGCAGTCTC GAGGGCTACA AGACGCTGTA CGACGATGTG GACGTGGTCA CCATCCGTGA GAACACCGAG GGCGAGTACT CCGGCATCGA GCACGAGATC GTCGACGGCG TCGTTCAGAG CATCAAGCTG ATCACCGAGG AAGCCTCCAA GCGTGTGGCC GAGTACGCCT TCCAGTACGC CAAGAACAAC AACCGCAAGA AGG