Note: this item is temporarily unavailable.
 
DETAILED VIEW
VDRC ID 40276
Library GD Stocks (GD)
Construct ID 10283
CG Number (r6.01) CG43427
FlyBase gene number FBgn0037267
FBgn0263346
FBgn0044530
FBgn0051534
FBgn0051531
FBgn0037269
FBgn0037266
FBgn0037268
Synonyms
anon-WO0140519.95
CG1054
CG1055
CG14653
CG18253
CG31531
CG31534
Hairpin Length 328
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability lethal
Inserted Chromosome 2
Left Primer CGCGAATTCGAGGAGCGCCAGTTGGAGGA
Right Primer GCGTCTAGATGGATGTGGGATTGGGAGTGG
Template genomic
Sequence GAGGAGCGCC AGTTGGAGGA AGCAGCCAAT GCGGTCAACC AAATTGAAGC GGAGTTCGAT GAGCTGACTG ATCTGCATCC CTCGCCATTG CCACCATCTC CAGCTCTTCC GGCGGTTCAA CAAAGCCTCC AACAACCGAC AGTCGCTCAG GTTCCAGCAC AAGCGGTCAA TCAGGCGGCT GCTCCTCCAT TGCGGGACAT GGAATTTAGT GTAAGTTGTA CTAACAATTT TATCGAACCC GCTAAGATAA GTCCTTGTGA TGTTAATGTA GTAGCTGCTT CAGCGGTGTC GGTGTCCAAA TCTGGCCCCA CTCCCAATCC CACATCCA