Note: this item is temporarily unavailable.
 
DETAILED VIEW
VDRC ID 40037
Library GD Stocks (GD)
Construct ID 9157
CG Number (r6.01) CG1594
FlyBase gene number FBgn0004864
FBgn0001211
FBgn0003895
FBgn0022799
Synonyms 4
d-jak
DmHD-160
Dm JAK
HD-160
hop
Hop
HOP
Hop1
hop/JAK
hopscotch
Hopscotch
HOPSCOTCH
Hopskotch
jak
Jak
JAK
JAK kinase
Janus-family kinase
Janus kinase
l(1)10Be
l(1)G18
l(1)hop
l(1)L4
L4
locus 18
msvl
Tum
Tum-1
Tumorous
Hairpin Length 364
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability lethal
Inserted Chromosome 2
Left Primer CGCGAATTCACCGGCGAATTTGAGCGTTTC
Right Primer GCGTCTAGAGTCCCGTTGATTTGTCCTTGTGCT
Template genomic
Sequence ACCGGCGAAT TTGAGCGTTT CCATCCCAAC ATGCTGTGCG AGGAGATCTG CAATACGATG TGCCGCCAGC TGGGCATTGC ACCAATTGCC CAGCTGCTCT ACGGAATACG GGAGCACTCG ACATCGCGAC GTCCCTCGCC GCTGGTGCGT TTGGATCTGA CGTGGTGCCT GCCCGGCGAG CGACTCAACT GCCAGCTGGT CTATTGCTTT CGGATGCGTT TCCGTGTGCC CGAATTGGAT AGCCAGCTGG AGTTGATCGA TGGACGGAGC CACAAGTTCC TCTACCGCCA AATGCGCTAC GATATGCGGA CCGAGCAAAT CCCGGAGATT CGCTATCCGG AGCACAAGGA CAAATCAACG GGAC