DETAILED VIEW
VDRC ID 3793
Library GD Stocks (GD)
Construct ID 1522
CG Number (r6.01) CG9774
FlyBase gene number FBgn0028698
FBgn0026181
Synonyms DRhk
DRho-kinase
drok
dRok
dROK
Drok
DRok
DROK
Drosophila rho-associated kinase
Rhk
RhoA kinase
rho-associated kinase
Rho-associated kinase
Rho-associated protein kinase
RhoK
rho kinase
Rho kinase
Rho-kinase
RHO kinase
Rock
ROCK
ROCK1
ROCK-1
ROCK2
rok
Rok
ROK
ROKalpha/beta
Rok/ROCK
Hairpin Length 303
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCTGGTGGTCGGTGGGCATTTT
Right Primer CGCTCTAGAGGAGGAGAGTTCGGGCACCAC
Template genomic
Sequence TGGTGGTCGG TGGGCATTTT CCTCTACGAG ATGCTGTTCG GCGAGACACC ATTCTACGCA GACTCGCTGG TGGGCACCTA CGGCAAGATC ATGGACCACA AGAACTCGCT TAGCTTTCCA CCCGAGGTTG AGATCAGCGA ACAGGCGAAG GCACTGATCC GCGCCTTTCT CACGGACCGA ACGCAACGTT TGGGTCGCTA CGGCATCGAG GACATTAAGG CGCATCCGTT TTTCCGAAAT GATACCTGGT CGTTCGACAA CATTCGCGAG AGTGTGCCGC CTGTGGTGCC CGAACTCTCC TCC