DETAILED VIEW
VDRC ID 35105
Library GD Stocks (GD)
Construct ID 11966
CG Number (r6.01) CG44746
FlyBase gene number FBgn0004366
FBgn0036960
FBgn0265959
Synonyms CG13814
CG6571
DmrdgC-77B
rdgC
RdgC
RDGC
RdgC 77B
RDGC/PP5
retinal degeneration C
Hairpin Length 351
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCGCGCCTACATCCGGCTTAACAAC
Right Primer GCGTCTAGACATCCGTGTCCAGCAGATCCAAC
Template genomic
Sequence GCGCCTACAT CCGGCTTAAC AACCAGCTGA TGCCCCATTT CGTTCAGTAC ATATCGGCGG CATCGCAGAC CAAGCGATTA TCCTTCAAAC AGCGAATGGG CATCGTGGAG AGTTCGGCAC TCAAGGAGTT GGCGGTGCGT ATGCGCGACC ATCGGGACGA GTTGGAGGAC GAGTTCCGGA AGTATGATCC CAAGGATAGC GGCTATATAT CCATATCGCA CTGGTGCAAG GTAATGGAGA ACGTGACCAA GTTGGGGCTG CCCTGGAGAC TCCTACGCGA TAAACTGGCA CCAGGCACGG ATAGTCAAAA GGTTAACTAT AATAGGACGT TGGATCTGCT GGACACGGAT G