DETAILED VIEW
VDRC ID 342532
Library HD CFD Stocks (HD-CFD)
HD-CFD ID HD_CFD02089
FlyBase gene number FBgn0003944
Construct CFDlib02089
FBgnr FBgn0003944
Synonym
Landing Site attP40
Vector pCFD6
Inserted Chromosome 2
Target sgRNA1 AATGAACTCGTACTTTGAAC
Target sgRNA2 AGTCCCGTTAGCCATCGCGG
Publication Port et al., eLife, 2020
Link Port et al., eLife, 2020
Link
Provider Scientist Boutros Laboratory
Provider Organization German Cancer Research Center (DKFZ) and Heidelberg University
Category sgRNA