DETAILED VIEW
VDRC ID 342510
Library HD CFD Stocks (HD-CFD)
HD-CFD ID HD_CFD01936
FlyBase gene number FBgn0000546
Construct CFDlib01936
FBgnr FBgn0000546
Synonym
Landing Site attP40
Vector pCFD6
Inserted Chromosome 2
Target sgRNA1 AAGTTAATTTGGTACCAGGA
Target sgRNA2 GCAAGAAGGGACCTGCGCCA
Publication Port et al., Biorxiv, 2019 (preprint)
Link Port et al., Biorxiv, 2019 (preprint)
Link
Provider Scientist Boutros Laboratory
Provider Organization German Cancer Research Center (DKFZ) and Heidelberg University
Category sgRNA