DETAILED VIEW
VDRC ID 34249
Library GD Stocks (GD)
Construct ID 10653
CG Number (r6.01) CG6811
FlyBase gene number FBgn0036257
Synonyms CG 6811
RhoGAP68F
Rho GTPase activating protein at 68F
Hairpin Length 396
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability lethal
Inserted Chromosome 2
Left Primer CGCGGATCCGAACAGTCCGTGCTTAAACTCCATTCC
Right Primer CGCGAATTCTCGCAGTCCATCACCCTGACC
Template genomic
Sequence GAACAGTCCG TGCTTAAACT CCATTCCGCC AATTGTGCGC AAGTGCGTGG ACTCGCTGTC CATAACGGGC GTGATCGATA CGGAGGGCAT ATTCCGTCGA TCGGGCAATC ACTCGGAGAT CATGGCGCTC AAGGAGCGCG TCAACCGCGG CGAGGATGTG GATCTGAAGA GCGTTAATGT CCACGTGATA GCCGGCCTGC TGAAGAGTTT CCTGCGCGAT CTCGCCGAGC CGCTGCTCAC CTTCGAGCTG TACGAGGATG TGACCGGTTT TCTAGACTGG CCCAAGGAAG AGCGTTCGAG GAACGTGACG CAACTGATAC GCGAAAAACT GCCAGAGGAG AACTATGAAC TGTTCAAGTA CATTGTTGAG TTCCTGGTCA GGGTGATGGA CTGCGA