DETAILED VIEW
VDRC ID 342323
Library HD CFD Stocks (HD-CFD)
HD-CFD ID HD_CFD02096
FlyBase gene number FBgn0003067
Construct CFDlib02096
FBgnr FBgn0003067
Synonym
Landing Site attP40
Vector pCFD6
Inserted Chromosome 2
Target sgRNA1 GGAGACGATTCCCACTCCAG
Target sgRNA2 TTGCTTTGTTCAATGAGCTC
Publication Port et al., Biorxiv, 2019 (preprint)
Link
Provider Scientist Boutros Laboratory
Provider Organization German Cancer Research Center (DKFZ) and Heidelberg University
Category sgRNA