DETAILED VIEW
VDRC ID 342013
Library HD CFD Stocks (HD-CFD)
HD-CFD ID HD_CFD01367
FlyBase gene number FBgn0010379
Construct CFDlib01367
FBgnr FBgn0010379
Synonym
Landing Site attP40
Vector pCFD6
Inserted Chromosome 2
Target sgRNA1 GGAACAGACTCAGGTCGTAA
Target sgRNA2 ACGACTCTCGGTCAGGGTAT
Publication Port et al., Biorxiv, 2019 (preprint)
Link
Provider Scientist Boutros Laboratory
Provider Organization German Cancer Research Center (DKFZ) and Heidelberg University
Category sgRNA