DETAILED VIEW
VDRC ID 33581
Library GD Stocks (GD)
Construct ID 9842
CG Number (r6.01) CG2887
FlyBase gene number FBgn0030207
Synonyms
Hairpin Length 352
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 3
Viability sterile
Inserted Chromosome 3
Left Primer CGCGAATTCGGCTGTAAGGCTGGCACCAAGA
Right Primer GCGTCTAGATGGCGTCTGGAAACTGGATGG
Template genomic
Sequence GGCTGTAAGG CTGGCACCAA GATCTGCTTT CCCAATGAGG GTATTCAACT GCCCAACCTT GAGCCCGCCA ACGTCGTGTT TATAATCCGG GACAAGCCAC ACCCAATCTT TCGCCGCGAT GGCAACAATC TGCTGTACAC AGCCGAAATC TCGCTGAAGG ATGCTCTGTG CGGTTTACAC GTGATGGTGC CGACGCTTCT TGGCAGGCCG ATGGAACTCA AGACCGACGT GGGCGAGGTA ATCAGTCCGA AATCCGTGCG CCGCATTCTG GGCTACGGAT TGCCCGATTC CATTAATAAT TCCCGTCGCG GCTCCATCGT CGTCAGGTTC TCCATCCAGT TTCCAGACGC CA