DETAILED VIEW
VDRC ID 33112
Library GD Stocks (GD)
Construct ID 564
CG Number (r6.01) CG31136
FlyBase gene number FBgn0066005
FBgn0042210
FBgn0039148
FBgn0023459
FBgn0013343
FBgn0010900
Synonyms anon-EST:Gibbs4
anon-WO02059370.54
CG10716
CG18615
CG5448
CT30033
Dm Syx1
DmSyx1A
dsyn-1A
dsyntaxin-1A
Dsyntaxin-1A
dSyx1
l(3)06737
STX1A
synt
syntaxin
Syntaxin
SYNTAXIN
syntaxin1
syntaxin 1
syntaxin-1
Syntaxin 1
syntaxin1A
syntaxin 1A
syntaxin-1A
Syntaxin1A
Syntaxin 1A
Syntaxin-1A
Syntx 1
syt-1A
Syt1A
syx
Syx
SYX
syx1
syx-1
Syx1
syx1A
syx-1A
Syx1a
Syx1A
Syx-1A
SYX1A
SYX 1A
SyxA
Hairpin Length 337
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGGATCCCATCCTGTCCGCCCCACAAA
Right Primer CGCTCTAGAGCCCTCCTCCAGCATCTTCTCC
Template genomic
Sequence CATCCTGTCC GCCCCACAAA CGGACGAGAA GACCAAGCAA GAGCTGGAGG ATCTGATGGC CGACATCAAG AAGAATGCCA ATCGCGTTCG CGGCAAGCTC AAGGGCATCG AGCAGAACAT CGAGCAGGAA GAGCAGCAGA ATAAGTCGTC GGCGGATCTG AGAATTCGGA AGACGCAGCA CTCGACGTTG TCACGGAAAT TCGTCGAAGT GATGACCGAG TACAATCGCA CGCAGACCGA CTACCGAGAG CGCTGCAAGG GAAGGATACA GCGTCAACTG GAGATTACCG GACGACCGAC CAACGACGAT GAGCTGGAGA AGATGCTGGA GGAGGGC