DETAILED VIEW
VDRC ID 330754
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG18426
FlyBase gene number FBgn0034916
FBgn0021895
Synonyms b(2)gcn
bgcn
l(2)60A-F
l(2)k13108
l(2)k13214
yantar
ytr
YTR
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
AGGAGCGATCCGAGCGGAAGA
21bp Sequence
(antisense)
TCTTCCGCTCGGATCGCTCCT
Hairpin Length 71
Sequence ctagcagtAGGAGCGATCCGAGCGGAAGAtagttatattcaagcataTCTTCCGCTCGGATCGCTCCTgcg
Category shRNA stocks