DETAILED VIEW
VDRC ID 330743
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG14734
FlyBase gene number FBgn0037976
Synonyms Drm-TK
Drm-TK-1
Drm-TK-2
Drm-TK-3
Drm-TK-4
Drm-TK-5
Drm-TK-6
dtk
Dtk
DTK
DTK1
DTK-1
DTK-2
DTK-3
DTK-4
DTK-5
DTK-6
neurokinin
preprotachykinin
tachykinin
Tachykinin
tachykinin-1
tachykinin-3
tachykinin-6
tachykinin-like peptide
Tachykinin-related
TAP-5
Tk
TK
TK-1
Tyk
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
CAAGAAATTCATCCCAATCAA
21bp Sequence
(antisense)
TTGATTGGGATGAATTTCTTG
Hairpin Length 71
Sequence ctagcagtCAAGAAATTCATCCCAATCAAtagttatattcaagcataTTGATTGGGATGAATTTCTTGgcg
Category shRNA stocks