DETAILED VIEW
VDRC ID 330682
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG5520
FlyBase gene number FBgn0039562
Synonyms CT17486
glycoprotein93
glycoprotein 93
Glycoprotein 93
gp93
Gp93
GP93
Hsp90
p93
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
CGAGGGCGAGGTGACCTTCAA
21bp Sequence
(antisense)
TTGAAGGTCACCTCGCCCTCG
Hairpin Length 71
Sequence ctagcagtCGAGGGCGAGGTGACCTTCAAtagttatattcaagcataTTGAAGGTCACCTCGCCCTCGgcg
Category shRNA stocks