DETAILED VIEW
VDRC ID 330679
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG5092
FlyBase gene number FBgn0021796
FBgn0032466
Synonyms 5092
CT16317
CT24745
CT24817
DmTOR
dtor
dTor
dTOR
FRAP/TOR
l(2)k17004
mTOR
target of rapamycin
target-of-rapamycin
Target of rapamycin
Target-of-rapamycin
Target of Rapamycin
Target Of Rapamycin
target of rapamycin kinase
tor
Tor
TOR
Tor|TOR
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
TCGACACGGAGCTCACATCAA
21bp Sequence
(antisense)
TTGATGTGAGCTCCGTGTCGA
Hairpin Length 71
Sequence ctagcagtTCGACACGGAGCTCACATCAAtagttatattcaagcataTTGATGTGAGCTCCGTGTCGAgcg
Category shRNA stocks