Note: this item is temporarily unavailable.
 
DETAILED VIEW
VDRC ID 330586
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG18076
FlyBase gene number FBgn0020296
FBgn0014183
FBgn0013733
FBgn0022170
FBgn0021937
FBgn0015972
FBgn0022208
FBgn0021837
FBgn0022152
FBgn0022230
Synonyms 42/4
CG18637
groovin
grv
Grv
kak
kakapo
Kakapo
kakapoo
kop
kopupu
l(2)CA4
l(2)k03010
l(2)k04204
l(2)k05434
l(2)k05821
l(2)k10821
l(2)k15606
shortshop
shortstop
short stop
short-stop
Shortstop
Short stop
Short Stop
shortstop/kakapo
shot
Shot
Spectraplakin
Su(Mir)1
Vector pWALIUM20
Landing Site attP40
Viability sterile
Inserted Chromosome 2
21bp Sequence
(sense)
TGGTTGAAGTAGAAGCATTAA
21bp Sequence
(antisense)
TTAATGCTTCTACTTCAACCA
Hairpin Length 71
Sequence ctagcagtTGGTTGAAGTAGAAGCATTAAtagttatattcaagcataTTAATGCTTCTACTTCAACCAgcg
Category shRNA stocks