DETAILED VIEW
VDRC ID 330586
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG18076
FlyBase gene number FBgn0020296
FBgn0014183
FBgn0013733
FBgn0022170
FBgn0021937
FBgn0015972
FBgn0022208
FBgn0021837
FBgn0022152
FBgn0022230
Synonyms 42/4
CG18637
groovin
grv
Grv
kak
kakapo
Kakapo
kakapoo
kop
kopupu
l(2)CA4
l(2)k03010
l(2)k04204
l(2)k05434
l(2)k05821
l(2)k10821
l(2)k15606
shortshop
shortstop
short stop
short-stop
Shortstop
Short stop
Short Stop
shortstop/kakapo
shot
Shot
Spectraplakin
Su(Mir)1
Vector pWALIUM20
Landing Site attP40
Viability sterile
Inserted Chromosome 2
21bp Sequence
(sense)
TGGTTGAAGTAGAAGCATTAA
21bp Sequence
(antisense)
TTAATGCTTCTACTTCAACCA
Hairpin Length 71
Sequence ctagcagtTGGTTGAAGTAGAAGCATTAAtagttatattcaagcataTTAATGCTTCTACTTCAACCAgcg
Category