DETAILED VIEW
VDRC ID 330564
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG13968
FlyBase gene number FBgn0032840
Synonyms 38B.2
Drm-sNPF
Drm-sNPF-1
Drm-sNPF-2
Drm-sNPF-3
Drm-sNPF-4
Drm-sNPF-AP1
lrlrfa
LRLRFamide
LRLRFamides
Neuropeptide F (short)
precursor of short neuropeptide F
short neuropeptide F
Short neuropeptide F
Short Neuropeptide F
short neuropeptide F1
short neuropeptide F-1
short neuropeptide F precursor
short NPF
Short NPF
small neuropeptide F
small neuropeptide-F
small neuropeptide F-1
snpf
sNPF
s-NPF
sNPF1
sNPF-1
sNPF-1[4-11]
sNPF-2
sNPF-2[12-19]
sNPF-2s
sNPF3
sNPF-3
sNPF-4
sNPF precursor
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
TGCCGACTACGACGGACTGTA
21bp Sequence
(antisense)
TACAGTCCGTCGTAGTCGGCA
Hairpin Length 71
Sequence ctagcagtTGCCGACTACGACGGACTGTAtagttatattcaagcataTACAGTCCGTCGTAGTCGGCAgcg
Category shRNA stocks