Note: this item is temporarily unavailable.
 
DETAILED VIEW
VDRC ID 330545
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG10161
FlyBase gene number FBgn0026594
FBgn0039100
FBgn0040227
Synonyms 153314_at
BEST:GM10514
eiF3p66
eIF3p66
eIF-3p66
eIF3-S7
Eukaryotic initiation factor 3 p66 subunit
GM04979
GM10514
Vector pWALIUM20
Landing Site attP40
Viability lethal
Inserted Chromosome 2
21bp Sequence
(sense)
CGACAAGGTGTTCATGGACAA
21bp Sequence
(antisense)
TTGTCCATGAACACCTTGTCG
Hairpin Length 71
Sequence ctagcagtCGACAAGGTGTTCATGGACAAtagttatattcaagcataTTGTCCATGAACACCTTGTCGgcg
Category