DETAILED VIEW
VDRC ID 330541
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG30446
FlyBase gene number FBgn0050446
FBgn0033091
Synonyms CG3686
dTdc2
tdc
tdc2
Tdc2
TDC2
tyrosine decarboxylase
tyrosine decarboxylase 2
Tyrosine decarboxylase 2
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
CGAGATCTGTAACCAAGTCAA
21bp Sequence
(antisense)
TTGACTTGGTTACAGATCTCG
Hairpin Length 71
Sequence ctagcagtCGAGATCTGTAACCAAGTCAAtagttatattcaagcataTTGACTTGGTTACAGATCTCGgcg
Category shRNA Stocks