DETAILED VIEW
VDRC ID 330540
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG5723
FlyBase gene number FBgn0024864
FBgn0011680
FBgn0004449
FBgn0011513
FBgn0011500
FBgn0010864
FBgn0037160
FBgn0047332
FBgn0011526
Synonyms 2017
5301
BcDNA:AT25108
CG11452
CT16449
l(3)00844
l(3)05301
l(3)05309
l(3)rJ307
l(3)rL201
l(3)rP126
odd Oz
odd-Oz
odd(Oz)
odz
Odz
odz/ten-m
Ten79E
tenascin-like molecule major
tenascin major
tenascin-major
Tenascin major
Tenascin-major
Teneurin
ten-m
ten(m)
ten[m]
Ten-m
Ten[m]
Ten-mc
ten-m/odz
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
AGGCGATGTGGAGTTCAACAA
21bp Sequence
(antisense)
TTGTTGAACTCCACATCGCCT
Hairpin Length 71
Sequence ctagcagtAGGCGATGTGGAGTTCAACAAtagttatattcaagcataTTGTTGAACTCCACATCGCCTgcg
Category shRNA Stocks