DETAILED VIEW
VDRC ID 330536
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG8238
FlyBase gene number FBgn0040491
FBgn0033646
Synonyms 48A-E Bcl-2-like
Bcl-2-48AE
buffy
Buffy
BUFFY
Buffy/Borg2
Buffy/dBorg-2
Buffy/DBorg-2
dBorg2
dBorg-2
dBORG-2/BUFFY
dbuffy
Dbx
Drob2
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
AGATCTGGTTTGTTCAACAAA
21bp Sequence
(antisense)
TTTGTTGAACAAACCAGATCT
Hairpin Length 71
Sequence ctagcagtAGATCTGGTTTGTTCAACAAAtagttatattcaagcataTTTGTTGAACAAACCAGATCTgcg
Category shRNA Stocks