DETAILED VIEW
VDRC ID 330518
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG9885
FlyBase gene number FBgn0010065
FBgn0000490
Synonyms blink
blk
BMP
bone morphogenetic protein
bone morphogenic protein
decapentaplegic
Decapentaplegic
Decapentaplegic/Bone Morphogenetic Protein
Dm-DPP
dpp
Dpp
DPP
DPP-C
Haplo-insufficient
heldout
Hin-d
ho
l(2)10638
l(2)22Fa
l(2)k17036
M(2)23AB
M(2)LS1
shortvein
shv
Tegula
Tg
TGF-b
TGFbeta
TGF-beta
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
CGACAGTTCAACGAAGTGCAT
21bp Sequence
(antisense)
ATGCACTTCGTTGAACTGTCG
Hairpin Length 71
Sequence ctagcagtCGACAGTTCAACGAAGTGCATtagttatattcaagcataATGCACTTCGTTGAACTGTCGgcg
Category shRNA Stocks