DETAILED VIEW
VDRC ID 330507
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG17520
FlyBase gene number FBgn0060573
FBgn0264492
FBgn0000258
FBgn0066006
FBgn0062248
Synonyms 0958/08
alphaCK2
alpha subunit of Drosophila casein kinase II
anon-WO02059370.53
casein kinase 2
casein kinase II
Casein kinase II
casein kinase IIalpha
casein kinase II alpha
Casein kinase II alpha subunit
Casein kinase II-alpha subunit
Cask-II-a
CJIIalpha
CK2
CK-2
CK2a
ck2alpha
Ck2alpha
CK2alpha
CK2 alpha
CK2-alpha
CkII
CKII
CK II
CK-II
CKIIa
CKIIalfa
ckIIalpha
CkIIalpha
CKIIalpha
CK-II alpha
CKII alpha
CKII-alpha
dCK2alpha
dCKII
dCKII alpha
DmCK2alpha
DmCKIIalpha
l(3)S095808
lethal (3) S095808
NAP1-kinase
protein kinase CK2
Tik
Timekeeper
Vector pWALIUM20
Landing Site attP40
Viability sterile
Inserted Chromosome 2
21bp Sequence
(sense)
TCGATCCAAGATTTCACGACA
21bp Sequence
(antisense)
TGTCGTGAAATCTTGGATCGA
Hairpin Length 71
Sequence ctagcagtTCGATCCAAGATTTCACGACAtagttatattcaagcataTGTCGTGAAATCTTGGATCGAgcg
Category shRNA Stocks