DETAILED VIEW
VDRC ID 330486
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG17678
FlyBase gene number FBgn0058010
FBgn0000384
Synonyms CG40010
conc
concertina
Concertina
cta
Cta
Galpha[[12/13]] subunit
mat(2)cta
mat(2)fog
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
AGAACGAATTTCCATTCCAAA
21bp Sequence
(antisense)
TTTGGAATGGAAATTCGTTCT
Hairpin Length 71
Sequence ctagcagtAGAACGAATTTCCATTCCAAAtagttatattcaagcataTTTGGAATGGAAATTCGTTCTgcg
Category shRNA Stocks