DETAILED VIEW
VDRC ID 330474
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG14716
FlyBase gene number FBgn0037933
Synonyms CT34507
dHO
DmHO
Haem oxygenase
heme oxygenase
Heme oxygenase
Ho
HO
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
AGAAGTAGTACGGACCATCAA
21bp Sequence
(antisense)
TTGATGGTCCGTACTACTTCT
Hairpin Length 71
Sequence ctagcagtAGAAGTAGTACGGACCATCAAtagttatattcaagcataTTGATGGTCCGTACTACTTCTgcg
Category shRNA Stocks