DETAILED VIEW
VDRC ID 330455
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG6103
FlyBase gene number FBgn0014467
FBgn0014468
FBgn0004972
FBgn0265784
Synonyms activator
blocker
cAMP-regulated enhancer-binding protein
cAMP response element-binding protein
cAMP-response element binding protein
cAMP-response element-binding protein
Creb
CREB
Creb17A
Creb2
CREB2
CREB2a
Creb2b
Creb2-b
Creb2.b
CREB2b
CrebB
CREB-b
CREB-B
Creb B 17A
CrebB-17A
CrebB17-A
CrebB-17B
CRE-BP
cyclic AMP response element binding protein
Cyclic-AMP response element binding protein B
Cyclic-AMP response element binding protein B at 17A
Cyclic-AMP response element binding protein B at 17B
dCbz
dCREB
dCreb2
dCREB2
dCREB-2
dCREB2a
dCREB-2a
dCREB2-a
dcreb2-b
dCreb2-b
dCREB2b
dCREB2-b
dCREB-B
dCrebB2
l(1)17Af
lethal(1)17Af
n
S162
Vector pWALIUM20
Landing Site attP40
Viability lethal
Inserted Chromosome 2
21bp Sequence
(sense)
TCCAACGGGTGCGACGAACAA
21bp Sequence
(antisense)
TTGTTCGTCGCACCCGTTGGA
Hairpin Length 71
Sequence ctagcagtTCCAACGGGTGCGACGAACAAtagttatattcaagcataTTGTTCGTCGCACCCGTTGGAgcg
Category shRNA Stocks