DETAILED VIEW
VDRC ID 330433
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG10967
FlyBase gene number FBgn0036313
FBgn0010715
FBgn0062118
FBgn0044321
FBgn0064136
FBgn0260945
Synonyms anon-WO0118547.287
atg1
Atg1
ATG1
autophagy-related gene 1
autophagy-specific gene1
Autophagy-specific gene 1
dAtg1
dATG1
DK-4
DmATG1
l(3)00305
Pegarn
ULK1
unc51
unc-51
Unc51
Unc-51
UNC 51-like
uncoordinated movement-51
Vector pWALIUM20
Landing Site attP40
Viability sterile
Inserted Chromosome 2
21bp Sequence
(sense)
CGAGACATTGTCCAAGCTGAA
21bp Sequence
(antisense)
TTCAGCTTGGACAATGTCTCG
Hairpin Length 71
Sequence ctagcagtCGAGACATTGTCCAAGCTGAAtagttatattcaagcataTTCAGCTTGGACAATGTCTCGgcg
Category shRNA Stocks