DETAILED VIEW
VDRC ID 330422
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG31012
FlyBase gene number FBgn0027598
FBgn0039803
FBgn0051012
Synonyms BcDNA:GH03163
CD2AP
CD2AP and CIN85 orthologue
CG11316
CG1408
CIN85 and CD2AP orthologue
cindr
Cindr
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
AGTCTAGCTATACGAAATCAA
21bp Sequence
(antisense)
TTGATTTCGTATAGCTAGACT
Hairpin Length 71
Sequence ctagcagtAGTCTAGCTATACGAAATCAAtagttatattcaagcataTTGATTTCGTATAGCTAGACTgcg
Category shRNA Stocks