DETAILED VIEW
VDRC ID 330383
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG9262
FlyBase gene number FBgn0005564
FBgn0003385
FBgn0003394
Synonyms DNK[[v]]4
dShal
Kv4
Shaker cognate 1
Shaker cognate l
Shaker cognate L
Shaker-like
shal
Shal
Shl
Sh-l
Vector pWALIUM20
Landing Site attP40
Viability sterile
Inserted Chromosome 2
21bp Sequence
(sense)
CGACGAGAAGCTCCTGATCAA
21bp Sequence
(antisense)
TTGATCAGGAGCTTCTCGTCG
Hairpin Length 71
Sequence ctagcagtCGACGAGAAGCTCCTGATCAAtagttatattcaagcataTTGATCAGGAGCTTCTCGTCGgcg
Category shRNA Stocks