DETAILED VIEW
VDRC ID 330376
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG9656
FlyBase gene number FBgn0004213
FBgn0001138
FBgn0019991
FBgn0015228
Synonyms CG9656-PA
dGATA-2
dGatac
dGATAc
Gata2
Gata-c
GATAc
GATA-factor-c
gra
grain
GRAIN
grn
Grn
l(3)84Fa
lethal(3)84Fa
Vector pWALIUM20
Landing Site attP40
Viability lethal
Inserted Chromosome 2
21bp Sequence
(sense)
TGGTACGATAGTCCGCGTTTA
21bp Sequence
(antisense)
TAAACGCGGACTATCGTACCA
Hairpin Length 71
Sequence ctagcagtTGGTACGATAGTCCGCGTTTAtagttatattcaagcataTAAACGCGGACTATCGTACCAgcg
Category shRNA Stocks