DETAILED VIEW
VDRC ID 330371
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG9652
FlyBase gene number FBgn0011582
Synonyms D[[1]] dopamine receptor
D1 dopamine receptor
D1-like DA receptor
D1-Like Dopamine Receptor
D1-like receptor
DA1
DA D[[1]]-like receptor
dDA1
dDA1/DmDOP1
D-Dop1
Dmdop1
DmDop1
DmDOP1
Dop1R1
Dopamine 1-like receptor 1
dopamine 1 receptor
dopamine D1-like receptor
dopamine D1 receptor
dopamine receptor
Dopamine receptor
DopR
DopR1
DopR35F
dumb
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
GGACCGCTACATTCACATCAA
21bp Sequence
(antisense)
TTGATGTGAATGTAGCGGTCC
Hairpin Length 71
Sequence ctagcagtGGACCGCTACATTCACATCAAtagttatattcaagcataTTGATGTGAATGTAGCGGTCCgcg
Category shRNA Stocks