DETAILED VIEW
VDRC ID 330355
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG7891
FlyBase gene number FBgn0037551
FBgn0062457
Synonyms Arl8
BcDNA:LD29185
Gie
GTPase indispensable for equal segregation of chromosomes
novel GTPase indispensable for equal segregation of chromosomes
Q9VHV5
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
ACGCTGCAGTGGTTAATTCAA
21bp Sequence
(antisense)
TTGAATTAACCACTGCAGCGT
Hairpin Length 71
Sequence ctagcagtACGCTGCAGTGGTTAATTCAAtagttatattcaagcataTTGAATTAACCACTGCAGCGTgcg
Category shRNA Stocks