DETAILED VIEW
VDRC ID 330349
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG7450
FlyBase gene number FBgn0062892
FBgn0004396
FBgn0010804
FBgn0041115
FBgn0004848
Synonyms Bbbf2
BBF-2
BBF2_DROME
BcDNA:SD05937
Box B-binding factor 2
BOX B Binding Factor-2
cAMP response element binding protein
cAMP response element binding protein A
creb
Creb
CREB
crebA
CrebA
Creb A
Creb-A
CREB-a
CREBA
CREB-A
CRE-BP
cyclic AMP response element binding protein
Cyclic-AMP response element binding protein A
dCrebA
dCreb-A
dCREBA
dCREB-A
l(3)03576
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
TGAAGAAGATTCGACGCAAAA
21bp Sequence
(antisense)
TTTTGCGTCGAATCTTCTTCA
Hairpin Length 71
Sequence ctagcagtTGAAGAAGATTCGACGCAAAAtagttatattcaagcataTTTTGCGTCGAATCTTCTTCAgcg
Category shRNA Stocks