DETAILED VIEW
VDRC ID 330334
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG5410
FlyBase gene number FBgn0039140
Synonyms B682
dmiro
dMiro
DmMiro
miro
Miro
Mitochondrial Rho
mitochondrial Rho-GTPase
Q8IMX7-1
Q8IMX7-2
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
TGGTCCTACTCCACCGACATA
21bp Sequence
(antisense)
TATGTCGGTGGAGTAGGACCA
Hairpin Length 71
Sequence ctagcagtTGGTCCTACTCCACCGACATAtagttatattcaagcataTATGTCGGTGGAGTAGGACCAgcg
Category shRNA Stocks