DETAILED VIEW
VDRC ID 330330
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG4589
FlyBase gene number FBgn0019886
Synonyms anon60Da
anon-60Da
B4D
dLetm1
DmLETM1
Letm1
LETM1 ortholog
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
CGAGGTGCGACAGGTAGTCAA
21bp Sequence
(antisense)
TTGACTACCTGTCGCACCTCG
Hairpin Length 71
Sequence ctagcagtCGAGGTGCGACAGGTAGTCAAtagttatattcaagcataTTGACTACCTGTCGCACCTCGgcg
Category shRNA Stocks