DETAILED VIEW
VDRC ID 330327
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG4201
FlyBase gene number FBgn0028725
FBgn0029160
FBgn0028726
FBgn0024222
FBgn0029099
Synonyms anon-89Bd
cactus kinase
DIK
dIKK
dIKKbeta
dIKK-beta
dLak
DLAK
DmIKK
Dmikkb
DmIKKb
dmIKKbeta
Dmikkbeta
DmIkkbeta
DmIKKbeta
DmIKKBeta
Ik
IK
ikk
IKK
Ikkb
IKKb
IKKB
Ikkbeta
IKKbeta
IKK-beta
IKK-like protein
immune response deficient 5
immune response-deficient 5
Immune response deficient 5
ird
ird5
ird-5
Ird5
Ird-5
IRD5
IRD-5
ird5/DmIkk[beta]
Lak
Lipopolysaccharide activated kinase
LPS-responsive kinase
LPS-responsive-kinase
LRK
mmune response deficient 5
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
ACGCGGTCAACTAGCAGCTAA
21bp Sequence
(antisense)
TTAGCTGCTAGTTGACCGCGT
Hairpin Length 71
Sequence ctagcagtACGCGGTCAACTAGCAGCTAAtagttatattcaagcataTTAGCTGCTAGTTGACCGCGTgcg
Category shRNA Stocks