DETAILED VIEW
VDRC ID 330316
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG32593
FlyBase gene number FBgn0264078
FBgn0030585
FBgn0027942
FBgn0024753
FBgn0052593
Synonyms CG11547
CG14409
DmFlo2
Flo
flo2
Flo2
Flo-2
FLO2
FLO[Dm]-2
flotillin
flotillin2
flotillin 2
flotillin-2
Flotillin2
Flotillin 2
Flotillin-2
flottilin 2
reggie1
reggie-1
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
CGGCGATGCAGCAATTATGAA
21bp Sequence
(antisense)
TTCATAATTGCTGCATCGCCG
Hairpin Length 71
Sequence ctagcagtCGGCGATGCAGCAATTATGAAtagttatattcaagcataTTCATAATTGCTGCATCGCCGgcg
Category shRNA Stocks