DETAILED VIEW
VDRC ID 330308
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG2049
FlyBase gene number FBgn0033399
FBgn0010625
FBgn0028556
FBgn0004459
FBgn0015480
FBgn0020621
FBgn0033398
Synonyms 3-2
CG2055
CT6637
CT6660
dPKN
Dpkn
DPKN
l(2)06736
l(2)45Ca
Pk?3
Pk45C
pkn
Pkn
PKN
PRK2
protein kinase c related
Protein kinase-like 45C
protein kinase N
Protein kinase N
Protein kinase related to protein kinase N
v(2)rG232
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
AGGAGGAAGTATTCGATTCAA
21bp Sequence
(antisense)
TTGAATCGAATACTTCCTCCT
Hairpin Length 71
Sequence ctagcagtAGGAGGAAGTATTCGATTCAAtagttatattcaagcataTTGAATCGAATACTTCCTCCTgcg
Category shRNA Stocks