DETAILED VIEW
VDRC ID 330274
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG10159
FlyBase gene number FBgn0013752
FBgn0015602
Synonyms beaf
BEAF
Beaf-32
BEAF32
BEAF-32
BEAF32A
BEAF-32A
BEAF32b
BEAF32B
BEAF-32B
boundary element associated factor
boundary element-associated factor
Boundary element-associated factor
boundary element associated factor 32
Boundary Element Associated Factor of 32
Boundary element-associated factor of 32kD
bs04c01.y1
Vector pWALIUM20
Landing Site attP40
Viability lethal
Inserted Chromosome 2
21bp Sequence
(sense)
AGGATATACTGTTCAAGGAAA
21bp Sequence
(antisense)
TTTCCTTGAACAGTATATCCT
Hairpin Length 71
Sequence ctagcagtAGGATATACTGTTCAAGGAAAtagttatattcaagcataTTTCCTTGAACAGTATATCCTgcg
Category shRNA Stocks