DETAILED VIEW
VDRC ID 330271
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG9809
FlyBase gene number FBgn0037248
Synonyms cg9809
CG 9809
dPCG1alpha
dPGC
dPGC-1
peroxisome proliferator-activated receptor gamma coactivator 1
PGC-1
PGC-1-alpha
spargel
Spargel
srl
Srl
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
AGCTTTGTTGCTTCAGGTAAA
21bp Sequence
(antisense)
TTTACCTGAAGCAACAAAGCT
Hairpin Length 71
Sequence ctagcagtAGCTTTGTTGCTTCAGGTAAAtagttatattcaagcataTTTACCTGAAGCAACAAAGCTgcg
Category shRNA stocks