DETAILED VIEW
VDRC ID 330266
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG8479
FlyBase gene number FBgn0010687
FBgn0261276
FBgn0084864
FBgn0033914
FBgn0086250
Synonyms dOpa1
dOPA1
Drosophila optic atrophy 1-like
l(2)s3475
lethal (2) s3475
opa1
Opa1
OPA1
opa1-like
Opa1-like
OPA1-like
optic atrophy 1
Optic atrophy 1
optic atrophy 1-like
Optic atrophy 1 ortholog (H. sapiens)
Vector pWALIUM20
Landing Site attP40
Viability lethal
Inserted Chromosome 2
21bp Sequence
(sense)
AGGATGGACTGCCGAATTTTA
21bp Sequence
(antisense)
TAAAATTCGGCAGTCCATCCT
Hairpin Length 71
Sequence ctagcagtAGGATGGACTGCCGAATTTTAtagttatattcaagcataTAAAATTCGGCAGTCCATCCTgcg
Category shRNA stocks